Forskjell mellom versjoner av «BioHackerLab»

Fra Bitraf
Hopp til navigering Hopp til søk
(37 mellomliggende revisjoner av 3 brukere er ikke vist)
Linje 1: Linje 1:
Noen navneforslag:
Biologi gruppen på Bitraf heter Bioraf.
BitLab? BioRaf? Biologiverksted? Biospace?
See also our chat channel #biohackers on To join, send yourself an invitation at
See also our chat channel #biohackers on To join, send yourself an invitation at
Linje 27: Linje 25:
*11. juli 2016: We performed PCR using 3 different yeast samples. As it became pretty late, the PCR samples were put in the freezer for later electrophoresis and checking of the results. To have something to look at, we performed electrophoresis of samples from the previous two PCR runs.
*11. juli 2016: We performed PCR using 3 different yeast samples. As it became pretty late, the PCR samples were put in the freezer for later electrophoresis and checking of the results. To have something to look at, we performed electrophoresis of samples from the previous two PCR runs. Update: The PCR samples were checked by electrophoresis July 24. 1 of 6 reactions was succesful. See
*Monday <strike>August 1</strike> August 8 2016: DIY Biolab: Using basic bioinformatics Tools; PyMOL:
*Monday August 22: DIY Biolab: A visit from the UiO iGEM team + strawberry DNA extraction:
*Monday September 5 2016: Bioraf byggekveld: We placed a book shelf in the main working space and put the equipment on it for easier access.
*Monday September 19 2016: Sequence Alignment Workshop:
=Planlagte meetups=
=Planlagte meetups=
*Monday August 1 2016: DIY Biolab: Using basic bioinformatics Tools; PyMOL:
= Videre jobbing =
= Videre jobbing =
Linje 41: Linje 47:
* 1x OpenPCR
* 1x OpenPCR
* Automatpipetter for områdene 1-10, 10-100 og 100-1000 uL. (2 sett)
* Automatpipetter for områdene 1-10, 10-100 og 100-1000 uL. (2 sett)
*1x Mikrosentrifuge for 1.5 mL-rør
*1x lavhastighets mikrosentrifuge for 1.5 mL-rør
*1x Vortex mixer
*1x Vortex mixer
*Elektroforese-kammer: 2x Carolina deluxe electrophoresis chamber
*Elektroforese-kammer: 2x Carolina deluxe electrophoresis chamber
Linje 47: Linje 53:
*1x DarkReader DR22A blue light transilluminator
*1x DarkReader DR22A blue light transilluminator
*Mikroskop: 1x Bresser Erudite DLX (ikke på Bitraf for øyeblikket)
*Varmeplate med magnetrører
*Varmeplate med magnetrører
*Eppendorf Biophotometer 6131
*Diverse pelistaltiske pumper
*Biohackacademy pelistaltisk pumpe
Linje 57: Linje 65:
[[Fil:Pipettes.jpg|miniatyr|Set of micropipettes; 1-10, 10-100 and 100-1000 uL. LHP brand (Liquid Handling Products).]]
[[Fil:Pipettes.jpg|miniatyr|Set of micropipettes; 1-10, 10-100 and 100-1000 uL. LHP brand (Liquid Handling Products).]]
[[Fil:I016 Biophotometer.jpg|miniatyr|Eppendorf Biophotometer 6131. Used for quantification of nucleic acids.]]
== Utstyr vi ønsker oss ==
== Utstyr vi ønsker oss ==
Linje 72: Linje 82:
* Filter-utstyr
* Filter-utstyr
* Vekst-medier
* Vekst-medier
* Qubit Spectrometer (or similar)
* Qubit Fluorometer
* Stereo mikroskop med minimum 400X. Ideelt et fasekontrast (phase contrast) mikroskop så vi kan se bakterier uten å måtte bruke fargestoffer.
* Mikroskop med minst 800x forstørrelse (x400 luft, x800 oljeimmersjon), Confokalt og fase kontrast. f.eks. [] Optika B-500TiPh fra japanphoto
*Presisjonsvekt (F.eks Kern EMB 100-3:
*Presisjonsvekt (F.eks Kern EMB 100-3:
*Mikroplateleser, ex. Tecan Infinite 200
*Mikroplateleser, ex. Tecan Infinite 200
Linje 235: Linje 245:
Arduino PCR thermal cycler for under $85:
[[Arduino]] PCR thermal cycler for under $85:
"Coffee Cup PCR":
"Coffee Cup PCR":
Linje 434: Linje 444:
===Guanidinium chloride===
Finnes i mange kommersielle kit for DNA-rensing. Typisk konsentrasjon kan være 5 M:
Faresetninger (Konsentrasjonsgrenseverdier for klassifisering som farlig avfall iht. COMMISSION REGULATION (EU) No 1357/2014):
*H302: 25%
*H315: 20%
*H319: 20%
Minste grenseverdi: 20%
Basert på dette vil en 5M løsning sannsynligvis regnes som farlig avfall.
Faresetninger (Konsentrasjonsgrenseverdier for klassifisering som farlig avfall iht. COMMISSION REGULATION (EU) No 1357/2014):
*H225: " If the presence of [the] substance indicates that the waste is flammable, it shall be classified as hazardous by HP 3"
*H319 (20%)
*H336 (no limit given)
==Aktuelle stoffblandinger==
==Aktuelle stoffblandinger==
Linje 662: Linje 696:
Exploring Personal Genomics:
Exploring Personal Genomics:
The Art of Fermentation: An In-Depth Exploration of Essential Concepts and Processes from around the World:
The Art of Fermentation: An In-Depth Exploration of Essential Concepts and Processes from around the World:
Budding Yeast: A Laboratory Manual:
Linje 698: Linje 733:
Anmeldelser, artikler, etc.:
Linje 773: Linje 810:
Clark et al. Extended stability of restriction enzymes at ambient temperatures. Biotechniques. 2000 Sep;29(3):536-8, 540, 542.:
Clark et al. Extended stability of restriction enzymes at ambient temperatures. Biotechniques. 2000 Sep;29(3):536-8, 540, 542.:
==Leverandører av utstyr og forbruksvarer==
==Leverandører av utstyr, tjenester og forbruksvarer==
===Forbruksvarer og reagenser===
===Forbruksvarer og reagenser===
Linje 788: Linje 825:
Linje 798: Linje 839:
'''General advice:'''
Linje 805: Linje 850:
LightRun sequencing:'\
LightRun sequencing:'
*Prepaid labels
*Premixed DNA and primer
*4.00 EUR / reaction, minimum order of 100
*(Welcome offer: 50 reactions for 3.50 EUR each)
SUPREMErun sequencing:
SUPREMErun sequencing:
Linje 816: Linje 866:
Standard sequencing:
Standard sequencing:
*5.99 EUR/reaction (express, 24 turnaround)
* 4.5 EUR/reaction (regular, 4-5 workdays turnaround)
*+2 EUR/reaction for purification
*EZseq single direct: 4.5 EUR/label (minimum order of 50).
*24hr turnaround
Sample purification is not offered with EZseq.
*Eco-seq single direct: 4.99 EUR/label (minimum order of 50)
*Eco-seq single purification: 6.99 EUR/label
Custom sequencing:
Custom sequencing:
Sample preparation guide:
Sample preparation guide:
From FAQ: "Minimum 20ul of 100ng/ul(plasmids, unpurified PCR products) or 50ng/ul(purified PCR products) are required for a couple of reactions."
Sample submission guide:
Sample submission guide:
Single run sequencing services:
Prepaid barcode sequencing:
*DNA purification and premixing with primer is done by the customer
Primers options:
*Separate sample and primer or premix possible
*Free usage of universal primers (see standard primer list)
*Custom primer, sent with the order (10 pmol/uL in volume >20 uL (enough for max.10 reactions)
Sample options:
*Bacteria for plasmid isolation (miniprep) on a agar plate or as glycerol stock
*Purified plasmid in a minimal volume of 30 ul with a DNA concentration of 50 – 200 ng/ul
*Purified or Raw PCR product in a minimal volume of 30 ul with a DNA concentration >5 ng/μl
Pricing: ??
Payment: Invoice by e-mail.
'''Source BioScience:'''
9.5 EUR/reaction for minimum order of 50 (475 EUR)
Concentration requirement for (purified) PCR product: 1ng/µl per 100bp
*Payment by credit card available.
==DIY/Open hardware==
==DIY/Open hardware==
Linje 830: Linje 937:
==Prosjekter til inspirasjon==
==Prosjekter til inspirasjon==
Linje 946: Linje 1 065:

Nåværende revisjon fra 27. feb. 2018 kl. 19:21

Biologi gruppen på Bitraf heter Bioraf.

See also our chat channel #biohackers on To join, send yourself an invitation at



Det har i det siste vært diskusjoner om å starte en egen lab for biologi på Bitraf. Bitraf har allerede medlemmer som jobber med hydroponics/aquaphonics og flere er interessert i ølbrygging. 18 Mai 2016 var det første møtet for folk som er interessert i å starte opp dette. Ønsket er å utvide foreningen med et lokale som egner seg for Gjør-det-selv-biologi og Biologi-hacking som retter seg etter norsk lov og de etiske retningslinjene fremsatt av European DIYbio Congress.

Summary from Bitraf's 1'st MeetUp:

Courses and Equipment:

Avholdte meetups

  • 27. juni 2016: Bruk av DNA-elektroforeseutstyret ble demonstrert, og de fleste fikk prøve pipettering av DNA til gel'en. Heikki presenterte utkast til brev til mulige sponsorer og tok i mot tilbakemeldinger.
Resultat av gel-elektroforese demonstrert på meetup 27.06.16. Spor #1 og 4-7 fra venstre: Dongsheng Biotech 1kb ladder (~5 uL). Spor 2,3 og 8: Dongsheng Biotech 50bp ladder (~5 uL). Bildet er tatt av Heikki Sørum.

Planlagte meetups

Videre jobbing

De av deltakerne som ønsket å jobbe med dette videre delte seg i to grupper som skal jobbe med Mikrobiologi og Utstyr til labben. Mikrobiologi-gruppen har planer for å jobbe med ølbrygging og klassifisering av gjær med Open PCR.

Result from PCR experiment 05 july 2016 to copy the 5.8S rRNA gene RDN58 and flanking ITS regions from yeast (S. cerevisae). Primers used were ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC). Primers were supplied by Macrogen Inc. Primer target concentration: 0.5 uM each. From left: DSBio 1kb ladder (5 uL), DSBio 50bp ladder (5 uL), PCR sample 1 (10 uL), PCR sample 2 (10 uL), PCR negative control (no template) sample (~5-10 uL). Electrophoresis at 75V for ~45 min on 1 % agarose with GelGreen DNA stain. Visualized with DarkReader DR22 transilluminator. PCR performed 05.07.16 with OpenPCR and DongSheng Biotech Taq mix. Reaction volume 50 uL. Template source is store bought dry yeast (Idun tørrgjær). Template source was prepared by dissolving 0.1 g dry yeast in 10 mL distilled water, and incubating 50 uL of the resulting yeast solution in a PCR tube at 98C for 10 min in openPCR. For PCR sample 1 and 2, 1 uL and 2 uL of the supernatant after incubation was added to the reaction mix, respectively. PCR program was as follows: Initital denaturation: 94C for 3 min. Repeated cycles: Denaturation: 94C for 30s. Anneal: 55.5C for 30s. Extension: 72C for 1 min. Final extension: 72C for 10 min. 35 cycles. Total run time: ~2h 20 min.

Utstyr vi har

  • 1x OpenPCR
  • Automatpipetter for områdene 1-10, 10-100 og 100-1000 uL. (2 sett)
  • 1x lavhastighets mikrosentrifuge for 1.5 mL-rør
  • 1x Vortex mixer
  • Elektroforese-kammer: 2x Carolina deluxe electrophoresis chamber
  • Elektroforesestrømforsyning: 1x BioRad PowerPac Basic.
  • 1x DarkReader DR22A blue light transilluminator
  • Mikrobølgeovn
  • Vanndestillasjonsapparat
  • Vannbad
  • Varmeplate med magnetrører
  • Eppendorf Biophotometer 6131
  • Diverse pelistaltiske pumper
  • Biohackacademy pelistaltisk pumpe
Electrophoresis equipment: Carolina deluxe gel chamber and BioRad PowerPac power supply. Bottles with 10x TAE buffer and electrophoresis-grade agarose (small bottle) are also visible.
Set of micropipettes; 1-10, 10-100 and 100-1000 uL. LHP brand (Liquid Handling Products).
Eppendorf Biophotometer 6131. Used for quantification of nucleic acids.

Utstyr vi ønsker oss

I tillegg trenger vi laboratoriemøbler/inventar som f.eks.:

  • Stålbenk/utslagsvask
  • Fumehood / labbenk
  • Filter til Fumehood
  • Oppvaskmaskin

PCR prosjekt

Hva er PCR?

  • Polymerase chain reaction/polymerase kjedereaksjon:
  • PCR brukes for å kopiere DNA. En PCR-maskin med reagenser er en "kopi-maskin" for DNA.
  • PCR kan brukes til å kopiere opp (amplifisere) DNA fra naturlige kilder/biologisk materiale for videre bearbeidelse eller analyse.
  • DNA-fragmenter med en kjent sekvens (rekkefølge på nukleotider, "bokstavene" i DNA) i hver ende velges ut og kopieres selektivt.
  • Sammensetning og lengde av DNA-tråden mellom start- og sluttpunktet kan variere. Informajson om lengden av DNA-fragmentene (visualiseres ved gel-elektroforese), og om kopiering fant sted (positiv/negativ reaksjon) kan brukes til å gjøre enkle genetiske analyser.
  • Opparbeidet DNA kan (gitt god nok mengde og kvalitet) sendes til nærmere analyse av DNA-sekvensen (sekvensering).

PCR visualization:

Hvorfor gjøre PCR?

  • En aktivitet med relativt lav terskel, med begrenset behov for opplæring, gode muligheter for å lykkes, overkommelige kostnader og få risikomomenter.
  • En klassisk molekylærbiologi-teknikk. I daglig bruk verden over. Uunnværlig for molekylærbiologisk forskning og medisinsk diagnostikk. Nobelpris-vinnende.
  • Potensiale for praktiske anvendelser med allmenn interesse. F.eks kontroll av artsopprinnelse for matvarer.

Hva trengs for PCR?

Fast utstyr:

  • PCR-maskin/thermocycler. Automatiserer temperaturegulering gjennom reaksjonsforløpet. Temperatur-regulering kan i teorien gjøres manuelt med vannbad ved ulike temperaturer, men dette blir temmelig langsomt og kjedelig
  • Mikropipette(r). Fortrinnsvis minst én automatpipette med justerbart volum i området 1-10 μL.
  • En eller flere flasker til agarose, ca. 250 mL. Glass eller varmebestandig plast, bør passe i mikrobølgeovn.
  • Mikrobølgeovn til oppvarming av agarose, evt. annen varmekilde + magnetrører
  • Gel-elektroforesekammer
  • Strømforsyning
  • Transilluminator m/filter og/eller filterbriller
  • Bør ha: Mikrosentrifuge.
  • Bør ha: Kjøleskap/fryser til oppbevaring av reagenser (PCR mastermix bør oppbevares frosset) og lage is
  • Kjekt å ha: Vanndestillator
  • Kjekt å ha: Liten isoporboks eller lignende til å ha is i, for kjøling av prøver under forberedelse.


  • Eppendorf-rør (plastrør tilpasset mikrosentrifuge, ca. 1.5 mL)
  • PCR-rør (plastrør tilpasset PCR-maskin, ca 0.5 mL)
  • Pipette-spisser til automatpipette(r)


  • PCR mastermix
  • TAE/TBE buffer, konsentrert
  • DNA-fargestoff (Riktig type med hensyn til transilluminator)
  • DNA-ladder (Blanding av DNA-fragmenter med kjent lengde. Brukes som referanse for lengde/størrelse av DNA-fragmenter ved elektroforese.)
  • DNA loading dye (Viskøs fargeblanding til utblanding av PCR-produkt før overføring til agarosegel. Kan "hjemmesnekres"?)
  • Elektroforese-agarose
  • DNA-primere (eksperiment-spesifikke)
  • Vann, fortrinnsvis destillert. Evt. flaskevann med lavt mineralinnhold.


  • Vernebriller
  • Engangshansker
  • Varmeisolerende hansker e.l. til håndtering av varm agarose
  • Fortrinnsvis labfrakk


  • Strøm gjennom elektroforesekammer (ca. 50-100 V)
  • Varm agaroseløsning
  • Støtkoking eller glasseksplosjon ved oppvarming av agarose i mikrobølgeovn. Unngås ved å begrense effekt/oppvarmingshastighet, begrense tid under oppvarming og aldri varme opp lukkede flasker/beholdere.
  • Potensielt skadelige kjemikalier (eks. Ethidum-bromid, "ETBR") og fargestoff som krever bruk av transilluminator med UV-stråling bør unngås. Alternativer med lavere risiko og bedre miljøprofil bør brukes, f.eks "GelGreen" fargestoff (brukes med transilluminator med synlig blått lys, redusert fare for øye/hudskader).


Avhenger av reagensvalg! Individuell vurdering må gjøres for hvert stoff. Generelt:

  • Størknet agarose kastes som restavfall. Flytende agarose må ikke tømmes i avløp, da dette vil størkne ved avkjøling.
  • Brukte bufferløsninger kan helles i avløp
  • Forbruksmateriell av plast med eventuelle reagensrester kastes i restavfall
  • Utstyr rengjøres med vann etter bruk

Reagenser, mulige leverandører og prisoverslag:


DongSheng Biotech:

Taq Mix:

Eksempel-bestilling (2014):

Product Name Cat No Description Qty Unit Unit Price Value

Taq Mix (2x) P2011 1 1ml $8.80 $8.80

Water, nuclease-free P9021 1 5x1ml $2.00 $2.00

PCR and DNA Fragment Purification Kit N1091 1 50preps $20.00 $20.00

50bp ladder M1041 1 50ug $16.00 $16.00

6xDNA Loading Dye M9041 1 5x1ml $4.60 $4.60

shipment viaFedEx $55.00

Total $106.40



GelGreen, (ca. $64.50 + shipping / 150 uL 10 000 x konsentrasjon. Nok til ca. 30-40 agarose-geleer.)

Suggested protocols for working with GelGreen:

GelRed-GelGreen Safety report:


TAE (Tris/Acetate/EDTA)-buffer, Promega: (390 kr/1000 mL 10x konsentrasjon = 39 kr/L ferdig buffer)

TAE elektroforesebuffer 50 x, Frederiksen Scientific: (1 250 kr/ 500 mL 50x konsentrasjon = 50 kr/L ferdig buffer

TBE (Tris/Borate/EDTA)-buffer kan også brukes.


Agarose, 10 g, Frederiksen Scientific: (kr 319 + frakt. Nok til ca. 10 agarose-gel'er (Gitt 50 mL 2 % agarose). Temmelig dyrt...Har tidligere kjøpt 100g på eBay for USD 40 + frakt.

DNA-primere: Macrogen Inc:

Ca. 0.2 EUR/basepar (bp) x ca. 30 bp x 2 primere = ca. 12 EUR Shipping ca 20 Sum ca. 30-40 EUR. (2013-priser)

Artikler/protokoller og lesestoff

DNA Learning Center Biology Animation Library - Polymerase Chain Reaction:

Possible sub-projects/experiments

In rough order of increasing difficulty/complexity?

  • Electrophoresis demonstration/equipment test: Demonstrate/test equipment and reagents for agarose gel electrophoresis. Separate and visualize DNA fragments of known size (DNA ladder).
  • PCR demonstration/equipment test: Demonstrate/test equipment and reagents for PCR and agarose gel electrophoresis. Amplify DNA fragment of known expected size from purified DNA or from biological material (yeast?). Visualize and determine size/length of the DNA fragment(s) by agarose gel electrophoresis.
  • Animal tissue/foodstuff species identification: Demonstrate/test identification of DNA from a suspected/known species in raw or processed food (ex, horsemeat).

DIY PCR-maskiner - Eksisterende design og prosjekter

Arduino PCR thermal cycler for under $85:

"Coffee Cup PCR":

Tilgjengelige primere

Navn Sekvens Beskrivelse Lengde Templat
Ec_lld_Rev GTTTCTTCCTGCAGCGGCCGCTACTAGTAtgcaggtctcctggagtccacgc REV-primer for E. coli lld promoter + RBS. Se 52 E. coli
Ec_lld_FWD GTTTCTTCGAATTCGCGGCCGCTTCTAGAGcacattcctataggccgagtaaggt FWD-primer for E. coli lld promoter + RBS. 55 E. coli
Fd2trim GAGTTTGATCATGGCTCAG Wide-range bacterial.
Porcine FWD + Porcine REV [2]


HorseSSR-FWD + HorseSSR-REV [2]:


S-D-Bact-0515-a-A-19 + S-D-Bact-0341-b-S-17 [1]

S-D-Bact-0515-a-A-19: 5'-TTA CCG CGG CTG CTG GCA C-3' (19mer) S-D-Bact-0341-b-S-17: 5'-CCT ACG GGN GGC WGC AG-3' (17mer)

[1]: See

[2]: See

Primers of interest / Shopping list


"V9D (5'-TTAAGTCCCTGCCCTTTGTA-3') and LS266 (5'-GCATTCCCAAACAACTCGACTC-3') are used to amplify an 800-1300 bp fragment that encompasses a portion of the 18S and 28S rRNA genes and the entire intervening ITS1, 5.8S and ITS2 rRNA regions." (Todd M Pryce. "Universal Detection and Identification of Fungi by PCR and DNA sequencing" in PCR for Clinical Microbiology, SpringerLink 2010.)

ITS 1 (5' TCCGTAGGTGAACCTGCGG 3') + ITS4 (5' TCCTCCGCTTATTGATATGC 3'). " In the present study, the restriction patterns generated from the region spanning the internal transcribed spacers (ITS1 and ITS2) and the 5.8S rRNA gene were used to identify a total of 132 yeast species belonging to 25 different genera, including teleomorphic and anamorphic ascomycetous and basidiomycetous yeasts." (, full text available through ResearchGate).

ITS1 and ITS4 available (10 USD for 100 reactions) from The ODIN:

E. coli:

rrnB p1_74bp_FWD_R caaccggtgttgcgcggtcagaaaatta rrnB p1_74bp_REV_R gtacatgtagtggtggcgcattatagg

Gives a short fragment.

pSB-M1g/pJP-1 plasmids:

pSB-SeqA/GFP-END-LVA-REV. Sequencing of and/or PCR demonstration using plasmid pSB-M1g. PCR from pSB-M1g without adding LVA tag should give fragment of aprox. 800 bp (size of GFP ORF + ~ 1 bp upstream).

pSB-SeqA: tgcaagaagcggatacag

GFP-END-LVA-REV: agaggatcccttaagttaagctactaaagcgtagttttcgtcgtttgctgctttgtatagttcatccatgcc (LVA sequence can be removed from the 5' end).

For PCR from pJP-1, replace pSB-seqA with pJP-1_seq5 (binding site is upstream of AgeI, as such this site is preserved from pSB-mg1, and this primer combination can also be used with pSB-mg1 for a longer PCR fragment)



Ved nødsfall

Giftinformasjonsentralen, døgnåpen vakttelefon: 22 59 13 00.

Legevakt: 116 117


Hva er farlig avfall? Se Forskrift om gjenvinning og behandling av avfall (avfallsforskriften) kapittel 11, Farlig avfall.I henhold til forskriftens §11-2 er farlig avfall definert som

  • a) avfall som skal klassifiseres som farlig i henhold til vedlegg 1 til kapitlet,
  • b) annet avfall som skal klassifiseres som farlig i henhold til vedlegg 2 nr. 1 til kapitlet.

Avfallsbesitter har ansvaret for å vurdere om avfallet omfattes av bestemmelsene i dette kapitlet.

Vedlegg 1 til forskriftens Kapittel 11 er Den europeiske avfallslisten (EAL). EAL angir at:

Som hovedregel skal avfall fra virksomheter m.m. som nevnt i kapittel 01 til 12 eller 17 til 20 i avfallslisten identifiseres ved hjelp av de sekssifrede avfallskodene i disse kapitlene.

Avfall som skal identifiseres ved hjelp av en avfallskode som er merket med stjerne, skal klassifiseres som farlig avfall med mindre Miljødirektoratet eller den Klima- og miljødepartementet bemyndiger har bestemt noe annet i medhold av § 11-2 tredje ledd.

Vedlegg 2 til forskriftens Kapittel 11angir Kriterier som gjør avfall farlig.

Punkt 1 av Vedlegg 2, Egenskaper som gjør avfall farlig, lyder som følger:

Ved vurderingen av om avfall som nevnt i § 11-2 bokstav b og vedlegg 1 nr. 3 annet ledd bokstav a skal klassifiseres som farlig, gjelder vedlegg III til direktiv 2008/98/EF (engelsk versjon) som endret ved forordning (EU) nr. 1357/2014, med unntak for HP 1, HP 9 og HP 15.(...)

Farlige stoffer:

Begrepet "farlige stoffer" brukes i forskriften. Hva er farlige stoffer? I henhold til forskriftens §11-3 er farlige stoffer definert som

stoffer som skal klassifiseres som farlige i henhold til forordning (EF) nr. 1272/2008 artikkel 3, jf. forskrift 16. juni 2012 nr. 622 om klassifisering, merking og emballering av stoffer og stoffblandinger (CLP).

I henhold til forordning (EF) nr 1272/2008 artikkel 3 er farlige stoffer definert som

A substance or a mixture fulfilling the criteria relating to physical hazards, health hazards or environmental hazards, laid down in Parts 2 to 5 of Annex I is hazardous and shall be classified in relation to the respective hazard classes provided for in that Annex.

Håndtering og levering av farlig avfall:

Det er ikke tillatt å fortynne farlig avfall for å komme under grenseverdiene, jf. DIRECTIVE 2008/98/EC artikkel 7 punkt 4.

Avfallsforskriftens § 11-5 først og andre ledd lyder som følger:

Farlig avfall skal tas hånd om på en forsvarlig måte. Alle som oppbevarer, transporterer eller håndterer farlig avfall, skal treffe nødvendige tiltak for å unngå fare for forurensning eller skade på mennesker eller dyr.

Farlig avfall skal ikke blandes sammen med annet avfall. Ulike typer farlig avfall skal ikke sammenblandes dersom dette kan medføre fare for forurensning, eller skape problemer for den videre håndteringen av avfallet.

Forskriftens §11-8 første ledd lyder som følger:

Virksomhet hvor det oppstår farlig avfall, skal levere dette til den som etter § 11-6 og § 11-7 kan håndtere avfallet, eller til virksomhet utenfor Norge i henhold til reglene om grensekryssende transport av avfall i kapittel 13. Det farlige avfallet skal leveres minst 1 gang pr. år. Plikten inntrer ikke før den totale mengden farlig avfall overstiger 1 kg.

Forskriftens §11-12 første punktum lyder som følger:

Virksomhet som leverer farlig avfall skal gi tilstrekkelige opplysninger om avfallets opprinnelse, innhold og egenskaper, slik at den videre håndteringen av avfallet kan skje på en forsvarlig måte.

Se også

Se også

Noen avfallskategorier som kan tenkes å være aktuelle:

  • 06 02 04 natrium- og kaliumhydroksid
  • 06 02 05 andre baser
  • 06 01 06 andre syrer
  • 20 01 13 løsemidler
  • 20 01 14 syrer
  • 20 01 15 baser

Aktuelle kjemikalier


Faresetninger: H315, H319, H335

Konsentrasjonsgrenseverdier for klassifisering som farlig avfall iht. COMMISSION REGULATION (EU) No 1357/2014 :

H315 & H319: 20%

H335: 20%


Faresetninger: H226, H314

Konsentrasjonsgrenseverdier for klassifisering som farlig avfall iht. COMMISSION REGULATION (EU) No 1357/2014 :

H226: N/A. Brannfarlighet må vurderes i hvert enkelt tilfelle.

H314: For farlig avfall klasse HP4 - 1%; For farlig avfall klasse HP8 - 5%

(Når avfall inneholder ett eller flere stoffer klassifisert som Skin corr. 1A, 1B eller 1C (H314) og summen av konsentrasjonene er høyere enn eller lik 5 %, skal avfallet klassifiseres som farlig avfall av typen HP 8.)

Ethylenediaminetetraacetic acid, disodium salt dihydrate (EDTA)

Faresetninger: H332, H373, H302, H315, H319,

Konsentrasjonsgrenseverdier for klassifisering som farlig avfall iht. COMMISSION REGULATION (EU) No 1357/2014 :

H332: 22,5%

H373: 10%

H302: 25%

H315 & H319: 20%

Minste grenseverdi: 10%


Guanidinium chloride

Finnes i mange kommersielle kit for DNA-rensing. Typisk konsentrasjon kan være 5 M:

Faresetninger (Konsentrasjonsgrenseverdier for klassifisering som farlig avfall iht. COMMISSION REGULATION (EU) No 1357/2014):

  • H302: 25%
  • H315: 20%
  • H319: 20%

Minste grenseverdi: 20%

Basert på dette vil en 5M løsning sannsynligvis regnes som farlig avfall.


Faresetninger (Konsentrasjonsgrenseverdier for klassifisering som farlig avfall iht. COMMISSION REGULATION (EU) No 1357/2014):

  • H225: " If the presence of [the] substance indicates that the waste is flammable, it shall be classified as hazardous by HP 3"
  • H319 (20%)
  • H336 (no limit given)

Aktuelle stoffblandinger

TAE buffer

Blanding av Tris-Acetate-EDTA. Se aktuelle kjemikalier for grenseverdier for de enkelte stoffene til bruk ved vurdering av klassifisering som farlig avfall. Typiske konsentrasjoner i 50x konsentret buffer kan være:

Tris: ~25% Eddiksyre: ´~6 %. EDTA: <1%.

Jf. begrensende grenseverdier for Tris, Eddiksyre og EDTA basert på disses faresetninger og lik henholdsvis 20%, 1% og 10% vil innholdet av Tris og eddiksyre dermed sannsynligvis medføre at konsentrert, ufortynnet 50X TAE buffer må klassifiseres som farlig avfall ved avhending. Se Aktuelle kjemikalier.

For 10X TAE buffer vil de aktuelle konsentrasjonene være ca.:

Tris: ~5% Eddiksyre: 1,2% EDTA: <0.2%

På grunn av innholdet av eddiksyre vil dermed også 10X TAE buffer sannynligvis klassifiseres som farlig avfall ved avhending.

Konsentrert buffer fortynnes typisk til 1x før bruk. Brukt buffer vil dermed sannsynligvis ikke inneholde konsentrasjoner av de nevnte stoffene over grenseverdiene, og kan i såfall avhendes som vanlig avfall. (OBS: Det er ikke tillatt å fortynne farlig avfall med den hensikt å komme under grenseverdiene).

Påkrevd piktogram iht. CLP: GHS07


EU-krav til sikkerhetsdatablader er gitt i Annex II til REACH:

Se også EHCA Guidance on the compilation of safety data sheets:


DSView Nucleic acid stain:

DSBio Taq mix (2x) P2011,P2012:

DSBio 50 bp ladder:

Notis: Inneholder 1-5% 2-amino-2-(hydroxymethyl)-1,3-propanediol, faresetninger Xi, R 36/37/38. (H319/H335/H315) (irriterende). Ufortynnet produkt klassifiseres derfor som farlig avfall klasse HP4., jf. Annex III to Directive 2008/98/EC som revidert ved EU-direktiv 1357/2014

DSBio gel loading dye:

DSBio NF water:

National Diagnostics TAE 50x:

Merck Millipore agarose for elektroforese:


Konverter fra r-setninger til H-setninger:

Kjemisk sikkerhet og din virksomhet - informasjonsplakat fra miljødirektoratet:

Innføring i klassifisering og merking av kjemikalier:

Plakat med oversikt over klassifisering og merking etter CLP:



Lab techniques

Alkaline lysis:

Andre grupper og nettsteder

BioHack Academy:

GenSpace (New York):

La paillasse (PAris)

Biologigaragen (København): &

Liste over grupper på Wiki:

Robert Carlson:

London Biohackspace:


WHO Laboratory Biosafety Manual, Third Edition:

Biosafety in Microbiological and Biomedical Laboratories 5th Edition, U.S. Department of Health and Human Services:

NTNU - Arbeid med biologiske faktorer:


Lover og forskrifter

Lover og forskrifter som er lenket til vil ikke nødvendigvis gjelde for aktiviteter ved Bitraf, men kan likevel brukes som en kilde til HMS-relevant informasjon og veiledning:

Norske forskrifter

Forskrift om særavgifter (relevant mht. bruk av teknisk sprit):§3-3-10

Forskrift om utforming og innretning av arbeidsplasser og arbeidslokaler (arbeidsplassforskriften) - Kapittel 8. Arbeid i omgivelser som kan medføre eksponering for biologiske faktorer:§8-1

Forskrift om tiltaksverdier og grenseverdier for fysiske og kjemiske faktorer i arbeidsmiljøet samt smitterisikogrupper for biologiske faktorer (forskrift om tiltaks- og grenseverdier) :

Forskrift om utførelse av arbeid, bruk av arbeidsutstyr og tilhørende tekniske krav (forskrift om utførelse av arbeid) -Andre del: Krav til arbeid med kjemiske og biologiske risikofaktorer:

Forskrift om begrensning i bruk av helse- og miljøfarlige kjemikalier og andre produkter (produktforskriften):

Merk spesielt §5-1:

§ 5-1.Omsetning og import av meget giftige og giftige kjemikalier til privat bruk Til privat bruk er det forbudt å importere kjemikalier merket med faresymbol og farebetegnelse «meget giftig» eller «giftig» i henhold til forskrift om klassifisering, merking mv. av farlige kjemikalier eller som i henhold til forordning (EF) nr. 1272/2008 om klassifisering, merking og emballering av stoffer og stoffblandinger (CLP-forordningen) skal klassifiseres i fareklasse og farekategori Carc. 1A, Carc. 1B, Muta. 1A, Muta. 1B, Repr. 1A, Repr. 1B, Acute Tox. 1, Acute Tox. 2, Acute Tox. 3, STOT RE 1 eller STOT SE 1. Forbudet mot privat import gjelder ikke for motorbensin eller dieselolje til transportformål som innføres på kjøretøyets drivstofftank eller i godkjente reservetanker


1272/2008 EC (CLP):

Forskrift om klassifisering, merking og emballering av stoffer og stoffblandinger (CLP):

Forholdet mellom REACH og CLP:

Offisiell tekst:

REACH angir plikter både for produsenter/importører og for "downstream users". "Downstream users" er definert som

"companies or individuals:

within the European Union/European Economic Area, who use a substance, either on its own or in a mixture, in their industrial or professional activities."

Antar at våre aktiviteter ikke vil omfattes av denne definisjonen?

Se også og

ECHA Navigator:

REACH database:



Biohackers: The Politics of Open Science:

Open-Source Lab: How to Build Your Own Hardware and Reduce Research Costs:

Biopunk: Solving Biotech's Biggest Problems in Kitchens and Garages:

The Machinery of Life:

Illustrated Guide to Home Biology Experiments:

Techniques in microbiology - a student handbook:

Biology Is Technology: The Promise, Peril, and New Business of Engineering Life:

Exploring Personal Genomics:

The Art of Fermentation: An In-Depth Exploration of Essential Concepts and Processes from around the World:

Budding Yeast: A Laboratory Manual:


DIY Bio:

European do-it-yourself (DIY) biology: Beyond the hope, hype and horror:


Synthetic biology: from mainstream to counterculture.:

DNA barcoding:

Nuclear ribosomal internal transcribed spacer (ITS)region as a universal DNA barcode marker for



Edwin: A Robotic Platform for Automated RNA Extraction and Analysis during Reporter Gene–Based Dynamic Characterization of Bacterial Promoters:


Kommersielt tilgjengelig utstyr

Anmeldelser, artikler, etc.:


"MiniPCR" (Samme pris som ferdigbygd OpenPCR, $650. Ikke DIY):


Elektroforese og transilluminasjon

DarkReader Blue Light Transilluminator:


Qubit 3.0 fluorometer: Listepris 15 340,00 NOK.

Spektrofotometer V1100D: Listepris 5 995,00 kr eks. MVA. Listepris ca. NOK 2,329.51.

Annet laboratorieutstyr

Kommersielt tilgjengelige reagenser og forbruksvarer


Peptone LP0037:

Oxoid yeast extract:


Elektroforese og transilluminasjon



Gjenkjenningssekvens (plusstråd/komplementær): GAATTC / GAATTC


Gjenkjenningssekvens (plusstråd/komplementær): GCGC / GCGC


Gjenkjenningssekvens (plusstråd/komplementær): GGCC / GGCC


Gjenkjenningssekvens (plusstråd/komplementær): GANTC/GANTC

Relevant litteratur:

Clark et al. Extended stability of restriction enzymes at ambient temperatures. Biotechniques. 2000 Sep;29(3):536-8, 540, 542.:

Leverandører av utstyr, tjenester og forbruksvarer

Forbruksvarer og reagenser (Selger bl.a. TAE buffer)



General advice:


LightRun sequencing:'

  • Prepaid labels
  • Premixed DNA and primer
  • 4.00 EUR / reaction, minimum order of 100
  • (Welcome offer: 50 reactions for 3.50 EUR each)

SUPREMErun sequencing:


Standard sequencing:

  • 5.99 EUR/reaction (express, 24 turnaround)
  • 4.5 EUR/reaction (regular, 4-5 workdays turnaround)
  • +2 EUR/reaction for purification


  • EZseq single direct: 4.5 EUR/label (minimum order of 50).
  • 24hr turnaround

Sample purification is not offered with EZseq.


  • Eco-seq single direct: 4.99 EUR/label (minimum order of 50)
  • Eco-seq single purification: 6.99 EUR/label

Custom sequencing:

Sample preparation guide:

From FAQ: "Minimum 20ul of 100ng/ul(plasmids, unpurified PCR products) or 50ng/ul(purified PCR products) are required for a couple of reactions."

Sample submission guide:




Single run sequencing services:

Prepaid barcode sequencing:

  • DNA purification and premixing with primer is done by the customer


Primers options:

  • Separate sample and primer or premix possible
  • Free usage of universal primers (see standard primer list)
  • Custom primer, sent with the order (10 pmol/uL in volume >20 uL (enough for max.10 reactions)

Sample options:

  • Bacteria for plasmid isolation (miniprep) on a agar plate or as glycerol stock
  • Purified plasmid in a minimal volume of 30 ul with a DNA concentration of 50 – 200 ng/ul
  • Purified or Raw PCR product in a minimal volume of 30 ul with a DNA concentration >5 ng/μl

Pricing: ?? Payment: Invoice by e-mail.

Source BioScience:

9.5 EUR/reaction for minimum order of 50 (475 EUR)

Concentration requirement for (purified) PCR product: 1ng/µl per 100bp

  • Payment by credit card available.

DIY/Open hardware

Prosjekter til inspirasjon







Om NCBI Genome Assembly model:



Saccharomyces cerevisiae:


The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now:

Brettanomyces (Dekkera) bruxellensis:



Nedlastbare programmer


Andre verktøy

In silico PCR:


Spanish Type Culture collection (CECT):




The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now:[orgn]

5.8S rRNA:

5.8S rRNA (RDN58-2) at SGD (Lokasjon chrXII:455414..455571)

5.8S rRNA (RDN58-1) at SgD: (Lokasjon: chrXII:455414-455571 reverse strand)

Chromosome XII context is important for rDNA function in yeast:


NCBI organism page:[orgn]

Crauwels et al. Assessing Genetic Diversity among Brettanomyces Yeasts by DNA Fingerprinting and Whole-Genome Sequencing. Appl Environ Microbiol. 2014 Jul; 80(14): 4398–4413.


Partial vinylphenol reductase purification and characterization from Brettanomyces bruxellensis.

Mesoplasma florum

